View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_low_38 (Length: 353)

Name: NF14819_low_38
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_low_38
NF14819_low_38
[»] chr7 (2 HSPs)
chr7 (15-121)||(2954314-2954418)
chr7 (280-316)||(19407005-19407041)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 2954418 - 2954314
Alignment:
Q  15 catctctttatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcactagtgtggccttta 114  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||    
T  2954418 catctcttcatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcact--tgtgggcttta 2954321  T
Q  115 tccctcg 121  Q
    | |||||    
T  2954320 tacctcg 2954314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 316
Target Start/End: Original strand, 19407005 - 19407041
Alignment:
Q  280 tcttgcatgtgatcgacttgtcttattgcatgagatg 316  Q
    |||||||||||||  ||||||||||||||||||||||    
T  19407005 tcttgcatgtgatacacttgtcttattgcatgagatg 19407041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University