View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_high_98 (Length: 209)

Name: NF14819_high_98
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_high_98
NF14819_high_98
[»] chr1 (1 HSPs)
chr1 (1-189)||(13278418-13278606)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 13278418 - 13278606
Alignment:
Q  1 cgagcagagaatagggaagcaattgcttaatagaaaaactactacagccactgtcttgtcggatacataagaacgattggctgattttcacgatcaatca 100  Q
    ||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  13278418 cgagcggagaataggtaagaaattgcttaatagaaaaactactacagccactgtcttgtcggatacataagaacgattggctgatttgcacgatcaatca 13278517  T
Q  101 ttttgtttttatgttcgctacttatcggttttctttcaatccgaatttaattatgaaatagtccaaaagatgaaaaatataagaataat 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  13278518 ttttgtttttatgttcgctacttatcggttttctttcaatccgaatttaattataaaatagtccaaaagatgaaaaatataagaataat 13278606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University