View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_high_69 (Length: 259)

Name: NF14819_high_69
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_high_69
NF14819_high_69
[»] chr8 (1 HSPs)
chr8 (46-159)||(8931362-8931475)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 46 - 159
Target Start/End: Complemental strand, 8931475 - 8931362
Alignment:
Q  46 aaataaagataagtttggtgaaaaaagtagttttgattatgttggtgataatggtattaatgaaaaagaagaaattgtgaatggtgttggtgttgttgaa 145  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8931475 aaatgaagataagtttggtgaaaaaagtagttttgattatgttggtgataatggtattaatgaaaaagaagaaattgtgaatggtgttggtgttgttgaa 8931376  T
Q  146 ggtattgggaatga 159  Q
    ||||||||||||||    
T  8931375 ggtattgggaatga 8931362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University