View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_high_65 (Length: 272)

Name: NF14819_high_65
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_high_65
NF14819_high_65
[»] chr3 (1 HSPs)
chr3 (55-259)||(30349564-30349768)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 55 - 259
Target Start/End: Complemental strand, 30349768 - 30349564
Alignment:
Q  55 caagtgccctcaaaattgtaaccccttgctaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata 154  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30349768 caagtgccctcaaaattgtaaccccttactaccatcaccgccgccgccaccaagattcgtatatgtaccagtgccaggtcaacctaaaccatattggata 30349669  T
Q  155 tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30349668 tattattactctggagctgaaagtagagcagtgaatttcctggttttggctttaggaggaggactctcgattgcaatgatttttggatgatatcatcatg 30349569  T
Q  255 aaact 259  Q
    |||||    
T  30349568 aaact 30349564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University