View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14818_low_15 (Length: 223)

Name: NF14818_low_15
Description: NF14818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14818_low_15
NF14818_low_15
[»] chr5 (1 HSPs)
chr5 (66-204)||(28320361-28320499)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 66 - 204
Target Start/End: Complemental strand, 28320499 - 28320361
Alignment:
Q  66 tatcgtttatttaaatcctacaaagcttaagatattagtctttgcagttgttcgtggaaatgatatctgatttacgctaaaaaataaaatatcatttctc 165  Q
    |||||||||||| |||||||||||  ||  ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  28320499 tatcgtttatttgaatcctacaaaatttgtgatattaatctttgcagttgatcgtggaaatgatatctgatttacgctaaaaaataaaatatcatttctc 28320400  T
Q  166 ataaaagttaagggaaatatggagattcttactccattt 204  Q
    |||||||||||||||||||||||||||||||||||||||    
T  28320399 ataaaagttaagggaaatatggagattcttactccattt 28320361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University