View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1480_low_26 (Length: 258)

Name: NF1480_low_26
Description: NF1480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1480_low_26
NF1480_low_26
[»] chr4 (1 HSPs)
chr4 (17-258)||(44464834-44465075)


Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 44464834 - 44465075
Alignment:
Q  17 agttttcgggtcaaactcaggctagtcagctgtttctcatagttcccgtctcatattaagccttcgattttgtattgtttttccaaaatatataatctaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
T  44464834 agttttcgggtcaaactcaggctagtcagctgtttctcatagttcccgtctcatattaaaccttcgattttgtattgtttttccgaaatatataatctaa 44464933  T
Q  117 ttgaatttataactgcaggttatattatgtaatgactgtgaaaagaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcct 216  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44464934 ttgaatttataactgcaggttattttatgtaatgactgtgaaaagaaaggagcagctcccttccactggctttaccacaaatgctcttgttgtggttcct 44465033  T
Q  217 ataacactagagttatatgattcttccagtgtgagcatagat 258  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  44465034 ataacactagagttatatgattcttccagtgtgagcatagat 44465075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University