View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14809_high_10 (Length: 288)

Name: NF14809_high_10
Description: NF14809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14809_high_10
NF14809_high_10
[»] chr8 (1 HSPs)
chr8 (18-178)||(38299214-38299374)
[»] chr3 (1 HSPs)
chr3 (18-178)||(4583185-4583340)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 38299374 - 38299214
Alignment:
Q  18 gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38299374 gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa 38299275  T
Q  118 ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38299274 ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg 38299214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 4583185 - 4583340
Alignment:
Q  18 gaaattagggttttggagagagagactaaggaaatgaagaagaggaagagacagtgagaaatgagttcttcccgggcttactatttatattccccccaaa 117  Q
    ||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||    
T  4583185 gaaattagggttttggagagaga-ac-aaggaaatgaagaagaggaagagactgtgagaaatgagttcttcccaggcttactatttatatt-cccccaaa 4583281  T
Q  118 ttgatgtacgatccgaaaccctaaacgggtaccctcgggtcagggttaaacgggttagccg 178  Q
    |||||||| |||| ||||||||||||  || ||||||||||| ||||||||||||||||||    
T  4583282 ttgatgtatgatctgaaaccctaaac-cgtgccctcgggtca-ggttaaacgggttagccg 4583340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University