View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14801_low_7 (Length: 262)

Name: NF14801_low_7
Description: NF14801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14801_low_7
NF14801_low_7
[»] chr7 (1 HSPs)
chr7 (138-245)||(12874479-12874586)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 138 - 245
Target Start/End: Original strand, 12874479 - 12874586
Alignment:
Q  138 atgtgataattgaattatgaaatcgagaaattaataaaggaataagcatgaagcatgataatgggaactaataattacgtatgtagatgttttctagtcc 237  Q
    |||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  12874479 atgtgataattgaattatgaaatcgagaaactaataaagaaataagcataaagcatgataatgagaactaataattacgtatgtagatgttttctagtcc 12874578  T
Q  238 aggttcat 245  Q
    ||||||||    
T  12874579 aggttcat 12874586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University