View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1479_low_33 (Length: 223)

Name: NF1479_low_33
Description: NF1479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1479_low_33
NF1479_low_33
[»] chr2 (2 HSPs)
chr2 (13-163)||(41467704-41467854)
chr2 (189-223)||(41467886-41467920)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 13 - 163
Target Start/End: Original strand, 41467704 - 41467854
Alignment:
Q  13 acaacataactatgacgataaaatattttaacctaaactgaaaaaatactaattaaaaagctaattaccactaccaacaaagaaattactcaatgattgt 112  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  41467704 acaacataactatgacgataaaatatttaaacctaaactgaaaaaatattaattaaaaagctaattaccactaccaacaaagaaattactcaatgatcgt 41467803  T
Q  113 gatatcattaacagagggatcgataattcatgtactacttgttcatcaaaa 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41467804 gatatcattaacagagggatcgataattcatgtactacttgttcatcaaaa 41467854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Original strand, 41467886 - 41467920
Alignment:
Q  189 gctagggcaggaacatagggcaagaggaatttttt 223  Q
    |||||||||||||||||||||||||||||||||||    
T  41467886 gctagggcaggaacatagggcaagaggaatttttt 41467920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University