View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14798_high_14 (Length: 376)

Name: NF14798_high_14
Description: NF14798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14798_high_14
NF14798_high_14
[»] chr1 (1 HSPs)
chr1 (18-57)||(6739160-6739199)


Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 6739199 - 6739160
Alignment:
Q  18 atgtgccgacaatggaagttccggtggtttctcaaagttt 57  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  6739199 atgtgccgacaatggaagttccggtggtttctcaaagttt 6739160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University