View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14791_low_27 (Length: 212)

Name: NF14791_low_27
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14791_low_27
NF14791_low_27
[»] chr7 (1 HSPs)
chr7 (20-180)||(33298373-33298533)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 180
Target Start/End: Original strand, 33298373 - 33298533
Alignment:
Q  20 tcttgatccatgagacaatttttacaaccatggcatgctgtttttgaaccttggaatttgtttaactaatgcatgatattgtgtaatgtattctacgtag 119  Q
    |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33298373 tcttgatccatgagaccatttttacaaccatggcatgctgttgttgaaccttggaatttgtttaactaatgcatgatattgtgtaatgtattctacgtag 33298472  T
Q  120 ttactgattacatgtaactctttctcaataagacacaaacatagttacgtggacctttccc 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33298473 ttactgattacatgtaactctttctcaataagacacaaacatagttacgtggacctttccc 33298533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University