View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14791_low_20 (Length: 239)

Name: NF14791_low_20
Description: NF14791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14791_low_20
NF14791_low_20
[»] chr1 (2 HSPs)
chr1 (20-169)||(29820266-29820415)
chr1 (186-222)||(29820219-29820255)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 29820415 - 29820266
Alignment:
Q  20 ggatggtcgagttcgtgggagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagat 119  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29820415 ggatggtcgagttcgtggaagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagat 29820316  T
Q  120 ggcatggatggcagagtttagaagttcttttccatactcttgaaggatga 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29820315 ggcatggatggcagagtttagaagttcttttccatactcttgaaggatga 29820266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
Q  186 atatacttctcccccttatacaaggagttcagcccta 222  Q
    ||||||| |||||||||||||||||||||||||||||    
T  29820255 atatactcctcccccttatacaaggagttcagcccta 29820219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University