View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14787_low_15 (Length: 219)

Name: NF14787_low_15
Description: NF14787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14787_low_15
NF14787_low_15
[»] chr5 (1 HSPs)
chr5 (92-135)||(2315038-2315081)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 92 - 135
Target Start/End: Original strand, 2315038 - 2315081
Alignment:
Q  92 gatgagaaagggaatccagggagagagtctatcactgcttgaat 135  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
T  2315038 gatgaggaagggaatccagggagagagtctatcactgcttgaat 2315081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University