View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14786_low_13 (Length: 226)

Name: NF14786_low_13
Description: NF14786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14786_low_13
NF14786_low_13
[»] chr4 (2 HSPs)
chr4 (121-226)||(22787637-22787742)
chr4 (15-67)||(22787729-22787781)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 121 - 226
Target Start/End: Complemental strand, 22787742 - 22787637
Alignment:
Q  121 ttcatgggactcccctaatgtgcatctagatttaattctaggtgtttatatatgttacatatctattgtacatgttacaatccactcaacctgtaattgt 220  Q
    |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22787742 ttcatggggctcccctaatgtgcatctagatttaattctagttgtttatatatgttacatatctattgtacatgttacaatccactcaacctgtaattgt 22787643  T
Q  221 tgctct 226  Q
    ||||||    
T  22787642 tgctct 22787637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 67
Target Start/End: Complemental strand, 22787781 - 22787729
Alignment:
Q  15 aatcagaactcaaattcatggggtattgtataataataattcatggggctccc 67  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  22787781 aatcagaactcaaattcattgggtattgtataataataattcatggggctccc 22787729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University