View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14784_low_95 (Length: 244)

Name: NF14784_low_95
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14784_low_95
NF14784_low_95
[»] chr2 (1 HSPs)
chr2 (1-244)||(35331726-35331969)


Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 35331969 - 35331726
Alignment:
Q  1 taataaataagattagagatatcaatatcaatataggagaatgacacaaaatcatcgtgtctttcccgccttaaagatagtagatcgggccccatttttt 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35331969 taataaatatgattagagatatcaatatcaatataggagaatgacacaaaatcatcgtgtctttcccgccttaaagatagtagatcgggccccatttttt 35331870  T
Q  101 gggggagatttcgatttagcatcgacacatcagattgaaaatgtgtgactatctttaaggaagttaatcatgtttattttctcaaattattattggtttc 200  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||    
T  35331869 gggggagatttcgatttagcatcgacacattagattgaaaatgtgtgactatctttaaggaagttaatcatgtttattttctcaaattattatcagtttc 35331770  T
Q  201 aacctctaagtggagtggttcatagggaggttttagtttacttt 244  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
T  35331769 aacctgtaagtggagtggttcatagggaggttttagtttacttt 35331726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University