View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14784_high_105 (Length: 226)

Name: NF14784_high_105
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14784_high_105
NF14784_high_105
[»] chr7 (1 HSPs)
chr7 (149-210)||(27841854-27841915)


Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 149 - 210
Target Start/End: Original strand, 27841854 - 27841915
Alignment:
Q  149 tgaagacatttggtacccaagtaacagatcttccaatcaccaatccaagctagtggtgaatg 210  Q
    |||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||    
T  27841854 tgaagacatttggtacacgagtaacagatattccaatcaccaatccaagctagtggtgaatg 27841915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University