View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14780_high_25 (Length: 248)

Name: NF14780_high_25
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14780_high_25
NF14780_high_25
[»] chr7 (2 HSPs)
chr7 (103-178)||(38706589-38706664)
chr7 (188-225)||(38706517-38706554)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 38706664 - 38706589
Alignment:
Q  103 tgctgttttattgttgtatttatgttgttccctctaggtcttggtaccttggagatctttgtttttgtatccctgt 178  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  38706664 tgctgttttgttgttgtatttatgctgttccctctaggtcttggtaccatggagatctttgtttttgtatccctgt 38706589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 225
Target Start/End: Complemental strand, 38706554 - 38706517
Alignment:
Q  188 tctaattttattttggcagttaaaaagttaaaataaaa 225  Q
    ||||||||||||||||||||||||||||||||||||||    
T  38706554 tctaattttattttggcagttaaaaagttaaaataaaa 38706517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University