View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14775_high_9 (Length: 235)

Name: NF14775_high_9
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14775_high_9
NF14775_high_9
[»] chr7 (1 HSPs)
chr7 (24-217)||(28265625-28265818)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 28265818 - 28265625
Alignment:
Q  24 gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28265818 gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat 28265719  T
Q  124 atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaattt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28265718 atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaattt 28265625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University