View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14769_low_11 (Length: 204)

Name: NF14769_low_11
Description: NF14769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14769_low_11
NF14769_low_11
[»] chr3 (1 HSPs)
chr3 (11-145)||(37762523-37762657)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 11 - 145
Target Start/End: Complemental strand, 37762657 - 37762523
Alignment:
Q  11 tgaaaccatgaaacgaattgaaagttgtctgccattgtaaggggacaatatggagtagagttgttcgatgttttgggcttgtgcgattgaggttagtagt 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  37762657 tgaaatcatgaaacgaattgaaagttgtctgccattgtaaggggacaatatggagtagagttgttcgatgttttgggtttgtgcgattgaggttagtagt 37762558  T
Q  111 tcattcatgtcgacgctacggtccatgtacgggga 145  Q
    |||||||||||||||||||||||||||||||||||    
T  37762557 tcattcatgtcgacgctacggtccatgtacgggga 37762523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University