View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14769_high_4 (Length: 224)

Name: NF14769_high_4
Description: NF14769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14769_high_4
NF14769_high_4
[»] chr3 (2 HSPs)
chr3 (1-207)||(26810185-26810391)
chr3 (125-158)||(26810140-26810173)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 26810391 - 26810185
Alignment:
Q  1 atagaagaaagagttcagggggaactaatgtacaacaataactatggaaaataataacaaaggaactggacccattaacccaaagccaatattttggctg 100  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26810391 atagaagaaagagtttagagggaactaatgtacaacaataactatggaaaataataacaaaggaactggacccattaacccaaagccaatattttggctg 26810292  T
Q  101 acccatgagcccaaaaattcaatgcaaaatcgaaacttgagattgaagttgtgtctggtgtctgccaccgacatgaaaatgacacaggcagttacattca 200  Q
    |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  26810291 acccatgagcccaaaaattctatgcaaaatcgaaacttaagattgaagttgtgtctggtgtccgccaccgacatgaaaatgacacaggcagttacattca 26810192  T
Q  201 tagcaaa 207  Q
    |||||||    
T  26810191 tagcaaa 26810185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 26810173 - 26810140
Alignment:
Q  125 caaaatcgaaacttgagattgaagttgtgtctgg 158  Q
    |||||||||||||| |||||||||||||||||||    
T  26810173 caaaatcgaaacttcagattgaagttgtgtctgg 26810140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University