View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14764_high_2 (Length: 224)

Name: NF14764_high_2
Description: NF14764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14764_high_2
NF14764_high_2
[»] chr6 (1 HSPs)
chr6 (15-210)||(3816022-3816226)


Alignment Details
Target: chr6 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 3816022 - 3816226
Alignment:
Q  15 atagggaggtgagtcaacatcaaagctgacataattgggaccatgcaaatgcagaaaaatgtgatggagtaagaggcattgggactatgttttatggaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3816022 atagggaggtgagtcaacatcaaagctgacataattgggaccatgcaaatgcagaaaaatgtgatggagtaagaggcattgggactatgttttatggaaa 3816121  T
Q  115 atgtgcttttcaatatgaatcaaatgcatttactattttaccatatgctactgttcaaa---------tcaaatggaatcattgtgagttttgaggagta 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||    
T  3816122 atgtgcttttcaatatgaatcaaatgcatttactattttaccatatgctactgttcaaatcaaatgagtcaaatggaatcattgtgagttttgaggagta 3816221  T
Q  206 cttac 210  Q
    |||||    
T  3816222 cttac 3816226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University