View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14762_low_21 (Length: 306)

Name: NF14762_low_21
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14762_low_21
NF14762_low_21
[»] chr7 (1 HSPs)
chr7 (18-291)||(25692884-25693157)


Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 25693157 - 25692884
Alignment:
Q  18 cgattatttgcatggtctccttatccatccagcaagattggtttagacgtgggagtgttacgcctcagtttattggccatgtgtgtgttcatgatacaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25693157 cgattatttgcatggtctccttatccatccagcaagattggtttagacgtgggagtgttacgcctcagtttattggccatgtgtgtgttcatgatacaat 25693058  T
Q  118 gtcatatattatacacggaaatatgcactagttaattgctttggaccttcttgtctcctgcatcacatggggtggaagagaaaattacgtggatagttta 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  25693057 gtcatatattatacacggaaatatgcactagttaattgctttggaccttcttgtctcctgcatcacatggggtggaagagaacattacgtggatagttta 25692958  T
Q  218 tatgcctaacatttatatttataattacgtgtgtgcgtgtttcagtttaaattaattttaaaggagtgtctgtg 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||    
T  25692957 tatgcctaacatttatatttataattacgtgtgtgcgtgtttcagtttaaattaattttgaaggagtgtttgtg 25692884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University