View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14762_high_14 (Length: 286)

Name: NF14762_high_14
Description: NF14762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14762_high_14
NF14762_high_14
[»] chr3 (1 HSPs)
chr3 (11-271)||(33424343-33424604)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 33424343 - 33424604
Alignment:
Q  11 ttttcctatttttacgttgggatgacattgcttatttacctgcactcaactctcatagtcaacgtggcttttcattaaaattcaaaacaaaaacgcaaca 110  Q
    |||||| | |||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33424343 ttttccaaattttacattgtgatgacattgcttattgacctgcactcaactctcatagtcaacgtggcttttcattaaaattcaaaacaaaaacgcaaca 33424442  T
Q  111 aatcagctcgtacacgtgagagcgaatgaaatccctaat-agggtttcaaattttttgtgcttttagttgttactaaataaaatccatgctcaatataaa 209  Q
    |||||||||||||  |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33424443 aatcagctcgtacctgtgagagcgaatgaaatccctaattagggtttcaaattttttgtgcttttagttgttactaaataaaatccatgctcaatataaa 33424542  T
Q  210 gatgaatggcactaagcataaaatgtgtgccaaattgggaggggtactaccaaatcatagag 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33424543 gatgaatggcactaagcataaaatgtgtgccaaattgggaggggtactaccaaatcatagag 33424604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University