View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14760_high_5 (Length: 237)

Name: NF14760_high_5
Description: NF14760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14760_high_5
NF14760_high_5
[»] chr4 (1 HSPs)
chr4 (1-223)||(9499784-9500006)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9499784 - 9500006
Alignment:
Q  1 tgaaccaaagcctctcccatcaccaacccccactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctgtacatggtttgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  9499784 tgaaccaaagcctctcccatcaccaacccccactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctgtacatggtctgtt 9499883  T
Q  101 attgtctgctagaatattatggcgtcgtttgatccacttagtgggataaggctaggttgttgtttattactgtttgctgaccgttctggtatgttgctgg 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  9499884 attgtctgctagaatattatggcgtcgtttgatccactcagtgggataaggctaggttgttgtttattactgtctgctgaccgttctggtatgttgctgg 9499983  T
Q  201 ccatccctcccactgttcttttt 223  Q
    |||||||||||||||||||||||    
T  9499984 ccatccctcccactgttcttttt 9500006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University