View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14758_low_37 (Length: 244)

Name: NF14758_low_37
Description: NF14758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14758_low_37
NF14758_low_37
[»] chr2 (2 HSPs)
chr2 (169-229)||(32916272-32916332)
chr2 (5-50)||(32916352-32916397)


Alignment Details
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 229
Target Start/End: Complemental strand, 32916332 - 32916272
Alignment:
Q  169 ttcctgagagatttgaccttaactaaagttcattaaccacttcaagccaagcacttgattt 229  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||    
T  32916332 ttcctgagagattcgaccttaactaaagttcattaaccacttcaagccatccacttgattt 32916272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 32916397 - 32916352
Alignment:
Q  5 agatcaaagaaaaaatatgaacattcaaagtaaaaccaataatgta 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  32916397 agatcaaagaaaaaatatgaacattcaaagtaaaaccaataatgta 32916352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University