View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14757_high_8 (Length: 404)

Name: NF14757_high_8
Description: NF14757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14757_high_8
NF14757_high_8
[»] chr1 (1 HSPs)
chr1 (304-384)||(14358354-14358434)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 8e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 304 - 384
Target Start/End: Complemental strand, 14358434 - 14358354
Alignment:
Q  304 tacaattcatttcttgcaatttcttcctactcgtggacagttgtgaaaccttcaatctcttacattcctcttggctcaatt 384  Q
    ||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||    
T  14358434 tacaattcatttcttgcaatttcttcctacttgtggacaattgtgaaaccttccatctcttacattcctcttggctcaatt 14358354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University