View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14755_low_17 (Length: 239)

Name: NF14755_low_17
Description: NF14755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14755_low_17
NF14755_low_17
[»] chr7 (1 HSPs)
chr7 (20-56)||(6591232-6591268)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 6591232 - 6591268
Alignment:
Q  20 aagaatatggtttaatgataaaaggatatattttaaa 56  Q
    |||||||||||||||||||||||||||||||||||||    
T  6591232 aagaatatggtttaatgataaaaggatatattttaaa 6591268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University