View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14752_low_17 (Length: 294)

Name: NF14752_low_17
Description: NF14752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14752_low_17
NF14752_low_17
[»] chr1 (2 HSPs)
chr1 (19-224)||(29820266-29820471)
chr1 (241-277)||(29820219-29820255)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 29820471 - 29820266
Alignment:
Q  19 taaaccagggttgttgctctaacagtttcaatgtataggtatctctctctacgcttggatggtcgagttcgtgggagtggtgttggttatccaccttgga 118  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  29820471 taaaccagggttgttgttctaacagtttcaatgtataggtatctctctctacgcttggatggtcgagttcgtggaagtggtgttggttatccaccttgga 29820372  T
Q  119 atgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29820371 atgctttcgttgcacaattaccgccggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaa 29820272  T
Q  219 ggatga 224  Q
    ||||||    
T  29820271 ggatga 29820266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
Q  241 atatacttctcccccttatacaaggagttcagcccta 277  Q
    ||||||| |||||||||||||||||||||||||||||    
T  29820255 atatactcctcccccttatacaaggagttcagcccta 29820219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University