View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14742_low_19 (Length: 310)

Name: NF14742_low_19
Description: NF14742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14742_low_19
NF14742_low_19
[»] chr4 (1 HSPs)
chr4 (1-84)||(4737199-4737282)
[»] chr8 (2 HSPs)
chr8 (172-230)||(2806529-2806587)
chr8 (139-171)||(2806607-2806639)
[»] chr5 (2 HSPs)
chr5 (139-171)||(34154339-34154371)
chr5 (216-250)||(34154297-34154331)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 4737199 - 4737282
Alignment:
Q  1 ttaaatttcatcttgaattctatgttgggacttttgactgtccacatgctttcaaaacaactgggcaataaaggggactaattg 84  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||    
T  4737199 ttaaatttcatcttgaattctatgttgggacttttcactgtccacatgctttcaaaacaaatgggcaataaaggggactaattg 4737282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 172 - 230
Target Start/End: Complemental strand, 2806587 - 2806529
Alignment:
Q  172 atcgtggcctatttacttggtagaatttgttggtcacacctaattaatagggtatacag 230  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||    
T  2806587 atcgtggcctatttacttggtagagtttgttggtcacacctaattaatatgctatacag 2806529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 171
Target Start/End: Complemental strand, 2806639 - 2806607
Alignment:
Q  139 ctaaaccgttttcttttgaccaagttatttagc 171  Q
    |||||||||||||||||||||||||||||||||    
T  2806639 ctaaaccgttttcttttgaccaagttatttagc 2806607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 139 - 171
Target Start/End: Complemental strand, 34154371 - 34154339
Alignment:
Q  139 ctaaaccgttttcttttgaccaagttatttagc 171  Q
    |||||||||||||||||||||||||||||||||    
T  34154371 ctaaaccgttttcttttgaccaagttatttagc 34154339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 250
Target Start/End: Complemental strand, 34154331 - 34154297
Alignment:
Q  216 taatagggtatacagttttgcaacgttattatatt 250  Q
    |||||||| ||||||||||||||||||||||||||    
T  34154331 taatagggcatacagttttgcaacgttattatatt 34154297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University