View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14738_high_27 (Length: 226)

Name: NF14738_high_27
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14738_high_27
NF14738_high_27
[»] chr6 (1 HSPs)
chr6 (7-226)||(866837-867052)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 866837 - 867052
Alignment:
Q  7 ggaatcacttctaacaaagaaagttcttgctgaatttaataatcatcgacacttcaaattaaaaatttgtttaggatctgacacttgtgtcagtgtcagt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||        
T  866837 ggaatcacttctaacaaagaaagttcttgctgaatttaataatcatcgacacttcagattaaaaatttgtttaggatctgacacttgtgtcagtgt---- 866932  T
Q  107 gtttggcatcggcaaatgttttata--ttcaattatttattttcttaaatagtatcagtgtcaatgtggtgtttggtgtctatatgcttcatagatatta 204  Q
      |||||||||||||||||||||||  ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  866933 --ttggcatcggcaaatgttttatatattcaattctttattttcttaaatagtatcagtgtcaatgtggtgtttggtgtctatatgcttcatagatatta 867030  T
Q  205 cattcaaaggattatcgtataa 226  Q
     |||||||||||||||||||||    
T  867031 tattcaaaggattatcgtataa 867052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University