View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14738_high_16 (Length: 306)

Name: NF14738_high_16
Description: NF14738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14738_high_16
NF14738_high_16
[»] chr1 (2 HSPs)
chr1 (138-290)||(3451391-3451543)
chr1 (138-169)||(3451343-3451374)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 138 - 290
Target Start/End: Original strand, 3451391 - 3451543
Alignment:
Q  138 gtgtatatgcttattattcctgtctcccatatcttcatagataagaaaactagtactagttcaattatgccttttttgtccatgtcgtgtgatcttcaac 237  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  3451391 gtgtatatgcttattattcctttctcccatatcttcatagataagaaaactagtactagttcgattatgccttttttgtccatgtcgtgtgatcttcaac 3451490  T
Q  238 actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct 290  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3451491 actcttgttctgatcatgttcacgagcacgcgaaacatcttctaccaatctct 3451543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 138 - 169
Target Start/End: Original strand, 3451343 - 3451374
Alignment:
Q  138 gtgtatatgcttattattcctgtctcccatat 169  Q
    ||||||||||||||||||||||||||||||||    
T  3451343 gtgtatatgcttattattcctgtctcccatat 3451374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University