View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14733_low_2 (Length: 438)

Name: NF14733_low_2
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14733_low_2
NF14733_low_2
[»] chr2 (2 HSPs)
chr2 (8-161)||(32489854-32490007)
chr2 (190-286)||(32490008-32490104)
[»] scaffold1019 (1 HSPs)
scaffold1019 (106-171)||(702-767)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 8 - 161
Target Start/End: Original strand, 32489854 - 32490007
Alignment:
Q  8 attatactagaaatggctgacttccaagagattatcttattattaaaccttacacctctagtgcattggaaatatccttgagctttctcattcacataaa 107  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  32489854 attatactagaaatggctgacttccaagagattatcttattattgaaccttacacctttagtgcattggaaatatccttgagctttctcattcacataaa 32489953  T
Q  108 tagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcat 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  32489954 tagagagaaatgctgatttaagaataacatcaatccaattgtagagagtatcat 32490007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 190 - 286
Target Start/End: Original strand, 32490008 - 32490104
Alignment:
Q  190 aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcagatgcaatgcacaaatagtctctaatgattatatcatgaa 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32490008 aaaaatggtcactctagtgtgtcaaagactttgttgtgcaagagattaacagcttcagatgcaatgcacaaatagtctctaatgattatatcatgaa 32490104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1019 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold1019
Description:

Target: scaffold1019; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 171
Target Start/End: Original strand, 702 - 767
Alignment:
Q  106 aatagagagaaatgctgatttaagaataacatcaatccaattgtagaaagtatcattcaaaccaaa 171  Q
    |||||||||||| ||||| || ||||| ||||||||||||||  |||||  |||||| ||||||||    
T  702 aatagagagaaaggctgactttagaatcacatcaatccaattacagaaaacatcattgaaaccaaa 767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University