View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14733_low_15 (Length: 218)

Name: NF14733_low_15
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14733_low_15
NF14733_low_15
[»] chr8 (1 HSPs)
chr8 (21-202)||(40052152-40052336)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 40052336 - 40052152
Alignment:
Q  21 atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggagg---taaatcggcat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||    
T  40052336 atttaattaacacaacaccttgattatacggtgcagatgggtaattggatggtactgatcaaaaatggattcggaggaggaggaggaggtaaatcggcat 40052237  T
Q  118 acacaacatcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgg 202  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40052236 acacaacgtcaactgtaccaaaaatgaaagcatatgctccaccagcatctgattatggacacattcatcacggacaacaacatgg 40052152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University