View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14733_high_13 (Length: 234)

Name: NF14733_high_13
Description: NF14733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14733_high_13
NF14733_high_13
[»] chr5 (1 HSPs)
chr5 (25-59)||(34837198-34837232)


Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 59
Target Start/End: Original strand, 34837198 - 34837232
Alignment:
Q  25 aacaaaataaaacacgtttggtaacattttctttg 59  Q
    |||||||||||||||||||||||||||||||||||    
T  34837198 aacaaaataaaacacgtttggtaacattttctttg 34837232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University