View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14730_high_20 (Length: 230)

Name: NF14730_high_20
Description: NF14730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14730_high_20
NF14730_high_20
[»] chr6 (1 HSPs)
chr6 (16-80)||(9577314-9577378)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 9577378 - 9577314
Alignment:
Q  16 atgaacataagaaggggttagaaatttaaaaccttaatataactaaacgtttgaacataacataa 80  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9577378 atgaacataagaaggggttagaaatttaaaaccttaatataactaaacgtttgaacataacataa 9577314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University