View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1472_low_35 (Length: 232)

Name: NF1472_low_35
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1472_low_35
NF1472_low_35
[»] chr6 (2 HSPs)
chr6 (1-81)||(8649837-8649917)
chr6 (76-199)||(8668267-8668388)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 8649837 - 8649917
Alignment:
Q  1 atgaagccaaacaacaaattgaattgaaaatactagatctggctgaaaaaactatgaaagctagtaaaacaacaaacaact 81  Q
    |||||||||||||||| |||||||||||||||||||||||||  ||| |||||||||||||||||||||||||||||||||    
T  8649837 atgaagccaaacaacagattgaattgaaaatactagatctggaagaagaaactatgaaagctagtaaaacaacaaacaact 8649917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 76 - 199
Target Start/End: Original strand, 8668267 - 8668388
Alignment:
Q  76 acaactaaaaccacaatatttaaaatannnnnnntgacagaaggggaggttctgatgtaacagatctggcttttagatggcccaatacaaaatgaggagg 175  Q
    ||||||||||||||||| |||||||||       ||||||||||||||||||||||||| |||||  ||||||||||||||| || |  |||||||||||    
T  8668267 acaactaaaaccacaatctttaaaataggggg--tgacagaaggggaggttctgatgtaccagattcggcttttagatggccaaaaaagaaatgaggagg 8668364  T
Q  176 agagatttcggtggagggaggtat 199  Q
    ||||||| ||||||||||||||||    
T  8668365 agagattccggtggagggaggtat 8668388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University