View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1472_low_34 (Length: 235)

Name: NF1472_low_34
Description: NF1472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1472_low_34
NF1472_low_34
[»] chr6 (2 HSPs)
chr6 (1-116)||(31410239-31410354)
chr6 (188-220)||(31410425-31410457)


Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 31410239 - 31410354
Alignment:
Q  1 ataaatattaacaatgaaatttcataaatgaagaagcaatttatggaatatcagttaggcattttcaccattatatctattaatttaattannnnnnnac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
T  31410239 ataaatattaacaatgaaatttcataaatgaagaagcaatttatggaatatcagttaggcattttcaccattatatctattaatttaattatttttttac 31410338  T
Q  101 gcaaacatactcatgg 116  Q
    ||||||||||||||||    
T  31410339 gcaaacatactcatgg 31410354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 220
Target Start/End: Original strand, 31410425 - 31410457
Alignment:
Q  188 ggttactgagtcattagtttttatggttgaacc 220  Q
    ||||||| |||||||||||||||||||||||||    
T  31410425 ggttactcagtcattagtttttatggttgaacc 31410457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University