View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14728_low_49 (Length: 246)

Name: NF14728_low_49
Description: NF14728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14728_low_49
NF14728_low_49
[»] chr7 (1 HSPs)
chr7 (97-237)||(38543505-38543645)
[»] chr5 (1 HSPs)
chr5 (166-198)||(5231903-5231935)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 97 - 237
Target Start/End: Complemental strand, 38543645 - 38543505
Alignment:
Q  97 gatagaaaatcatatactaaactaatgtaatcaactactttataacttttgttgagacagtgttaattatagataatattttattaattttaatagaata 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
T  38543645 gatagaaaatcatatactaaactaatgtaatcaactactttataacttttgttgaaacagtgtttattatagataatattttattaattttaatagaata 38543546  T
Q  197 tgagannnnnnnnatcaagtactagatttttattgaaagta 237  Q
    |||||        ||||||||||||||||||||||||||||    
T  38543545 tgagattttttttatcaagtactagatttttattgaaagta 38543505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 5231935 - 5231903
Alignment:
Q  166 tagataatattttattaattttaatagaatatg 198  Q
    ||||||||||||||||||||||| |||||||||    
T  5231935 tagataatattttattaattttagtagaatatg 5231903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University