View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14724_high_4 (Length: 247)

Name: NF14724_high_4
Description: NF14724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14724_high_4
NF14724_high_4
[»] chr3 (1 HSPs)
chr3 (1-230)||(47893851-47894080)
[»] chr2 (1 HSPs)
chr2 (112-162)||(38748172-38748222)
[»] chr8 (1 HSPs)
chr8 (94-183)||(42926175-42926264)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 47893851 - 47894080
Alignment:
Q  1 catcccggcgaaaaagctcgccggagagaccctcaaaaatacaattattccggcaatccttgccctgagtttcgcaaattaggaaactgcaccaaaggtg 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  47893851 catcccggtgaaaaagctcgccggagagaccctcaaaaatacaattattccggcaatccttgcccggagtttcgcaaattaggaaactgcaccaaaggtg 47893950  T
Q  101 attcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47893951 attcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaaccctttgccggagacgagt 47894050  T
Q  201 ttgtttctttgctcataccattgatcaact 230  Q
    ||||||||||||||||||||||||||||||    
T  47894051 ttgtttctttgctcataccattgatcaact 47894080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 38748222 - 38748172
Alignment:
Q  112 ttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaact 162  Q
    ||||||||||| |||||||||||||||||||||||| || | |||||||||    
T  38748222 ttcgctcatggcgtttttgaatgctggcttcatcctgctagatacagaact 38748172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 183
Target Start/End: Complemental strand, 42926264 - 42926175
Alignment:
Q  94 aaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaacc 183  Q
    ||||||||||| ||  | || |||||||||||||| || || |||||||||||||| |||||| | |||||||  ||||| |||||||||    
T  42926264 aaaggtgattcgtgtgagtttgctcatggtgttttcgagtgttggcttcatccttcgcgttaccgtactcagccgtgtaaagacggaacc 42926175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University