View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14718_low_15 (Length: 230)

Name: NF14718_low_15
Description: NF14718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14718_low_15
NF14718_low_15
[»] chr4 (1 HSPs)
chr4 (1-217)||(1220781-1221002)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 1221002 - 1220781
Alignment:
Q  1 accggcatttaattgggaaagaattatgggatatgtttgccatctttgtctttgtttgtgcatttctagtgtcttgccagtgagggtgttttctcttttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1221002 accggcatttaattgggaaagaattatgggatatgtttgccatctttgtctttgtttgtgcatttctagtgtcttgccagtgagggtgttttctcttttc 1220903  T
Q  101 acagggaaggcaaaaagtaaaggctacgttgggcagtcaaagatttagtatacttgtttcatgggg-----atttttcttttcacaggtcactatcgaag 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||    
T  1220902 acagggaaggcaaaaagtaaaggctacgttgggcagtcaaagatttagtatacttgtttcatggggatagcatttttcttttcacaggtcactatcgaag 1220803  T
Q  196 tattgatcacttcatctctgct 217  Q
    |||| |||||||||||||||||    
T  1220802 tattcatcacttcatctctgct 1220781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University