View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14715_low_16 (Length: 253)

Name: NF14715_low_16
Description: NF14715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14715_low_16
NF14715_low_16
[»] chr8 (2 HSPs)
chr8 (17-108)||(2550600-2550691)
chr8 (184-241)||(2550767-2550825)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 108
Target Start/End: Original strand, 2550600 - 2550691
Alignment:
Q  17 tttttcacgtctacttcttttcataaacattgatttattataaatttcacatctactattataactttgtatcttttacgacttgtcagttc 108  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  2550600 tttttcacgtttacttcttttcataaacattgatttattataaatttcaaatctactattataactttgtatcttttacgacttgtcagttc 2550691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 2550767 - 2550825
Alignment:
Q  184 aaaattgtcaattgcatattgcaaaa-aatagcgttatatttaaattttgctattctct 241  Q
    |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||    
T  2550767 aaaattgtcaattgcatattgcaaaaaaatagcgttttatttaaattttgctattctct 2550825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University