View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14713_low_66 (Length: 245)

Name: NF14713_low_66
Description: NF14713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14713_low_66
NF14713_low_66
[»] chr7 (2 HSPs)
chr7 (101-227)||(33111633-33111758)
chr7 (1-55)||(33111804-33111858)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 101 - 227
Target Start/End: Complemental strand, 33111758 - 33111633
Alignment:
Q  101 taagtgatttattggattttagacctttggattgagtgaaccnnnnnnngaggctgtcacaaaggctccttgaatcaagtttggctgatttccgaatctc 200  Q
    |||||| |||||||||||||||||||||||||||||||||||       |||||||| |||||||||||||||||||||||||||||||||||||||||     
T  33111758 taagtggtttattggattttagacctttggattgagtgaaccaaaaaaagaggctgttacaaaggctccttgaatcaagtttggctgatttccgaatct- 33111660  T
Q  201 ccaccaaaagttgataaccatattaat 227  Q
    |||||||||||||||||||||||||||    
T  33111659 ccaccaaaagttgataaccatattaat 33111633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 33111858 - 33111804
Alignment:
Q  1 tttgttgcttgattgcaatttttgcagaaggacgaggaggcatgtctatttttag 55  Q
    ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
T  33111858 tttgttgcttgattgtaatttttgcagaaggacgaggtggcatgtctatttttag 33111804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University