View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14712_high_15 (Length: 275)

Name: NF14712_high_15
Description: NF14712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14712_high_15
NF14712_high_15
[»] scaffold0189 (1 HSPs)
scaffold0189 (4-251)||(16570-16817)


Alignment Details
Target: scaffold0189 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 4 - 251
Target Start/End: Original strand, 16570 - 16817
Alignment:
Q  4 ggttgtgatgcaaataattaaaaattgttttagaggtttgtgtgcgcgtgtttagaatatatgtatatgtaattgaatcctcggttgtgatttatcatgt 103  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  16570 ggttgtgatgcaaataattaaaaattgttttagaggtttgtgtgcgcgtgtttagaatatatatatatgtaattgaatcctcggttgtgatttatcatgt 16669  T
Q  104 tagcatttttcttattcgttgcataggagtatactagtttctagagaaaatatccttaagattgtgattgtctaaatgtatgtgtttaggtaacatttca 203  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  16670 tagcatttttcttattcgttgcataggagtatactagtttgtagagaaaatatccttgagattgtgattgtctaaatgtatgtgtttaggtaacatttca 16769  T
Q  204 aacattgatgtattagcattcctatatcagaagggaaaatcttcattg 251  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  16770 aacattgatgtattagcattcctatatcagaagggaaaatcttcattg 16817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University