View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14711_low_29 (Length: 216)

Name: NF14711_low_29
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14711_low_29
NF14711_low_29
[»] chr2 (1 HSPs)
chr2 (1-216)||(45366883-45367098)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 45367098 - 45366883
Alignment:
Q  1 ttttagtgagtggccatctaatattgctattcacactttcacaaggaatcacttaatcttaaaatttagttttacagtagttagaatttgcttctcnnnn 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
T  45367098 ttttagtgagtggccatctaatattgctattcacactttcacaaggaatcacttaatcttaaaatttagttttacagtagttagaatttgcttctctttt 45366999  T
Q  101 nnnaatactgtcgtgataactgttaacaacatttggtgctggttgtgctgttacgacaatccatctgtgataaagaaattcatttctatgcattgacggt 200  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45366998 tttaatactgtcgtgataactgttaacaacatttggtgctggttgtgctgttacgacaatccatctgtgataaagaaattcatttctatgcattgacggt 45366899  T
Q  201 gaaactttcttacaca 216  Q
    ||||||||||||||||    
T  45366898 gaaactttcttacaca 45366883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University