View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14711_low_24 (Length: 238)

Name: NF14711_low_24
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14711_low_24
NF14711_low_24
[»] chr3 (2 HSPs)
chr3 (140-220)||(43758654-43758734)
chr3 (12-66)||(43758807-43758861)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 43758734 - 43758654
Alignment:
Q  140 aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtc 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43758734 aagtgataagatggatcatagtataaatcattatcagcattttagcatggatcgaaccttccaaaatttgcctcagctgtc 43758654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 43758861 - 43758807
Alignment:
Q  12 cgaagaaaatatcctcttcttacttaattggaattcaagatggtaatttagagag 66  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  43758861 cgaagaaaatatcctcttctcacttaattggaattcaagatggtaatttagagag 43758807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University