View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14711_high_21 (Length: 260)

Name: NF14711_high_21
Description: NF14711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14711_high_21
NF14711_high_21
[»] chr4 (1 HSPs)
chr4 (16-260)||(2057138-2057371)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 2057371 - 2057138
Alignment:
Q  16 tagacatatcaatttcaaaagctctaaggagctgtttaatccgtaacaactcattggttacaactgctaaagcacgatactcagcctcagtcgatgaacg 115  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||           |    
T  2057371 tagacatatcaatttcaaaagctctaaggagctgtttaatccataacaactcattggttacaactgctaaagcacgatactcagcctc-----------g 2057283  T
Q  116 tgactttgttgattgtttccttgacttccaagtaatcaagaattctccaagatagatgcaaaaccaattggttgatcatccacatatgttgtaactcgaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  2057282 tgactttgttgattgtttccttgacttccaagtaatcaagaattctccaagatagatgcaaaatcaattggttgatcatccacatatgttgtaactcgaa 2057183  T
Q  216 gtgctacaaaactattacccgagccattggtaaataacgaattct 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  2057182 gtgctacaaaactattacccgagccattggtaaataacgaattct 2057138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University