View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14709_low_13 (Length: 262)

Name: NF14709_low_13
Description: NF14709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14709_low_13
NF14709_low_13
[»] chr7 (1 HSPs)
chr7 (1-214)||(24946600-24946814)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 24946814 - 24946600
Alignment:
Q  1 ttaaaacacttgatagttatcgacctttggtcttttttcctaatttgacttttcatccatattcgaatgaccctattcccatcagaacttttttcaaa-c 99  Q
    |||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| ||||| ||||||| |    
T  24946814 ttaaaacacttgttagtaatcgacctttggtcttttttcctaatttgacttttcattcatatttgaatggccctattcccatcataacttgtttcaaaac 24946715  T
Q  100 cctggtttctgtctttgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatatgaattggaattgaa 199  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |    
T  24946714 cctggtttctgtctctgtcagtgtattcaaaattcattaatcgtgaatttcttggactacagtcttttcagtggttatctgaatattaatcggaattgga 24946615  T
Q  200 tgttctgatttgaaa 214  Q
    ||| |||||||||||    
T  24946614 tgtcctgatttgaaa 24946600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University