View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14706_low_17 (Length: 317)

Name: NF14706_low_17
Description: NF14706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14706_low_17
NF14706_low_17
[»] chr6 (1 HSPs)
chr6 (100-301)||(5346679-5346879)


Alignment Details
Target: chr6 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 100 - 301
Target Start/End: Complemental strand, 5346879 - 5346679
Alignment:
Q  100 caatggtatgacattatataagtagaaaggacaataaaattaaaatgaaacaataattatatggctctcgtatgacataataacctagtttatcctcaca 199  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5346879 caatggtatgacatgatataagtagaaaggacaataaaattaaaatgaaacaataattatatggctctcgtatgacataataacctagtttatcctcaca 5346780  T
Q  200 ctatactttagatttctcattcagacaacttttatcannnnnnnnnaagtacactggtaatgaatgtttaaaatttctttatcaatgattttacaatgat 299  Q
    |||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  5346779 ctatactttagatttctcattcagacaacttttatca-ttttttttaagtacactggtaatgaatgtttaaaatttctttatcgatgattttacaatgat 5346681  T
Q  300 at 301  Q
    ||    
T  5346680 at 5346679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University