View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14705_low_24 (Length: 263)

Name: NF14705_low_24
Description: NF14705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14705_low_24
NF14705_low_24
[»] chr2 (1 HSPs)
chr2 (177-246)||(43557100-43557169)


Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 177 - 246
Target Start/End: Original strand, 43557100 - 43557169
Alignment:
Q  177 ttttggttccagaagtaatttattgctatataaaaggtgcttgaaacattgaggaattagagtataacac 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43557100 ttttggttccagaagtaatttattgctatataaaaggtgcttgaaacattgaggaattagagtataacac 43557169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University