View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14704_high_19 (Length: 208)

Name: NF14704_high_19
Description: NF14704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14704_high_19
NF14704_high_19
[»] chr5 (2 HSPs)
chr5 (28-190)||(43027413-43027575)
chr5 (66-113)||(41395285-41395332)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 28 - 190
Target Start/End: Original strand, 43027413 - 43027575
Alignment:
Q  28 aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaaccaatgttacccaacaaccgtgtttta 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||  ||||||    
T  43027413 aatgaaggacatctcactttggtgccccacctatcttcgatacggatgttgaacttccctaaccctacaaaaatcaatgttacccaagaaccaagtttta 43027512  T
Q  128 tgttgtaaaagtcgcgtagagcacgccagcctttggtaaagaagatgccatagttgtttctct 190  Q
    ||||||||||| ||||||||||| ||| |||||||||||||||||||||| ||||||||||||    
T  43027513 tgttgtaaaagccgcgtagagcatgccggcctttggtaaagaagatgccacagttgtttctct 43027575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 113
Target Start/End: Original strand, 41395285 - 41395332
Alignment:
Q  66 gatacggatgttgaacttccctaaccctacaaaaaccaatgttaccca 113  Q
    ||||| ||| ||||||||| ||||||||||||| ||||||||||||||    
T  41395285 gatactgattttgaacttcactaaccctacaaagaccaatgttaccca 41395332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University